Enter Sequence to be examined: >try this sample sequence CTCTCTCTGTCGTCGTCCATAGCTACTGTCTGCTGCTG Search parameters Minimum no. of repeats (default = 3): Minimum repeat unit length (default = 2): Maximum repeat unit length (default = 100): Options Show summary report Show VNTR map Display potential primer design sequences N.B.: This tool incorporates the program Tandyman written by Robert Leach (2000), Los Alamos National Laboratory